View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1290-Insertion-12 (Length: 62)
Name: NF1290-Insertion-12
Description: NF1290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1290-Insertion-12 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 56; Significance: 5e-24; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 56; E-Value: 5e-24
Query Start/End: Original strand, 7 - 62
Target Start/End: Complemental strand, 6516856 - 6516801
Alignment:
| Q |
7 |
accaacatcactgatcttgctaacgtagtttttgtctaagagaatgtttcctggtt |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6516856 |
accaacatcactgatcttgctaacgtagtttttgtctaagagaatgtttcctggtt |
6516801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.00000000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 7 - 62
Target Start/End: Complemental strand, 42674005 - 42673950
Alignment:
| Q |
7 |
accaacatcactgatcttgctaacgtagtttttgtctaagagaatgtttcctggtt |
62 |
Q |
| |
|
||||||||| ||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
42674005 |
accaacatcgctgatcttgcttacgtagtttctgtctaagagaatgtttgctggtt |
42673950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 28; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 54
Target Start/End: Complemental strand, 3686681 - 3686634
Alignment:
| Q |
7 |
accaacatcactgatcttgctaacgtagtttttgtctaagagaatgtt |
54 |
Q |
| |
|
|||||||||||| || |||||||| | |||||||||||||||||||| |
|
|
| T |
3686681 |
accaacatcacttattttgctaacaaaatttttgtctaagagaatgtt |
3686634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University