View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1290-Insertion-8 (Length: 110)
Name: NF1290-Insertion-8
Description: NF1290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1290-Insertion-8 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 99; Significance: 2e-49; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 99; E-Value: 2e-49
Query Start/End: Original strand, 8 - 110
Target Start/End: Complemental strand, 7961314 - 7961212
Alignment:
| Q |
8 |
catggaagcacctcgtaaatgactacgaagcaaggaagaatagctctaggattgaaaacagttaaatcttcgagatttgagtaactcccagcattccccg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7961314 |
catggaagcacctcgtaaatgactacgaagcaaggaagaatagctctaggattgaaaacagttaaatcttctagatttgagtaactcccagcattccccg |
7961215 |
T |
|
| Q |
108 |
cag |
110 |
Q |
| |
|
||| |
|
|
| T |
7961214 |
cag |
7961212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University