View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12903_low_3 (Length: 473)
Name: NF12903_low_3
Description: NF12903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12903_low_3 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 365; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 365; E-Value: 0
Query Start/End: Original strand, 16 - 456
Target Start/End: Complemental strand, 30418857 - 30418412
Alignment:
| Q |
16 |
caaggagggccaaacatcatactggtagagatgagtgatggtttacttttgttgcacggaaatggtgaatttgtggtggggaggaagatggttgaagata |
115 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
30418857 |
caaggagggccaaacatcataatggtagagatgagtggtggtttacttttgttgcacggaaatggtgaatttgtggtggggaggaagatgattaaagata |
30418758 |
T |
|
| Q |
116 |
aggggtcatggaatttgaatatttaggatagggagtttttaaaaggtggcagaacaacttgaaattttcagattttgatgaagaaacggtggctgggaat |
215 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| ||| |
|
|
| T |
30418757 |
aggggtcatggaatttgaatatgtaggatagggagtttttaaaaggtggcagaacaacttgacattttcagattttgatgaagagacggtggctggaaat |
30418658 |
T |
|
| Q |
216 |
agtgtgatggtggcgagaatcaatatcatcacatctttggtaaggaggaccactcttcatcggcatctagtggtaaagcgaatcgattttgactcgtggg |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
30418657 |
agtgtgatggtggcgagaatcaatatcatcacatctttggtaaggaggaccactcttcatcggcatctagtggtaaagcggatcaattttgactcgtggg |
30418558 |
T |
|
| Q |
316 |
tggttgaaaagggcaacggaa----ggagtgccaggatctagaaaaacggtctgattttgaattttctggtacctcagtcggaaagttccagataaggtg |
411 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30418557 |
tggttgaaaagggcaacggaaggagggagtgctaggatctagaaaaacggtttgattttgaaatttctggtacctcagtcggaaagttccaaataaggtg |
30418458 |
T |
|
| Q |
412 |
gcgtgtgtggaggtt-gggggtttggatggtgagtgactctatgat |
456 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30418457 |
gcgtgtgtggaggttggggggtttggatggtgagtgactctatgat |
30418412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University