View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12904_high_13 (Length: 255)
Name: NF12904_high_13
Description: NF12904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12904_high_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 7 - 240
Target Start/End: Original strand, 18865661 - 18865894
Alignment:
| Q |
7 |
gcagcacagaccaaatattatcaaggtgaaagtgaattcagatagtgattataacagcggcaacaagttcagaagacttaacgtgcctcttacgctaaag |
106 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18865661 |
gcagcatagaccaaatattatcaagatgaaagtgaattcagatagtgattataacagcggcaacaagttcagaagacttaacgtgcctcttacgctaaag |
18865760 |
T |
 |
| Q |
107 |
tctagggttgggaagtttctgagcggtgtgatgcaggacgtgatgcgggagcaggacaagcctcaaaagttctaccgtgctatcacggaggagttgaagc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18865761 |
tctagggttgggaagtttctgagcggtgtgatgcaggacgtgatgcgggagcaggacaagcctcaaaagttctaccgtgctatcacggaggagttgaagc |
18865860 |
T |
 |
| Q |
207 |
tcttgaaggattgtagagattctgctcttaaaca |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
18865861 |
tcttgaaggattgtagagattctgctcttaaaca |
18865894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University