View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12904_high_15 (Length: 236)

Name: NF12904_high_15
Description: NF12904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12904_high_15
NF12904_high_15
[»] chr1 (1 HSPs)
chr1 (1-219)||(30472474-30472692)


Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 30472474 - 30472692
Alignment:
1 aatattgttgtctttcaaatcattgaaggcacgggttttgcttttgaataatatggttctagttatgcataagttggaccagattattaagaatttcacc 100  Q
    ||||||||||||||| ||||| ||||||||||| |||||||| |||||||||||| || ||||||||||||||||||||||||||| |||||||||||||    
30472474 aatattgttgtcttttaaatcgttgaaggcacgagttttgctcttgaataatatgtttatagttatgcataagttggaccagattactaagaatttcacc 30472573  T
101 agttcttgtaaccggaggaatatgtgcaacctcttcaccatgattggtgatgggtgaaggcgtggtaggtcgtttgttctttcgagtagtatggcaaaca 200  Q
     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
30472574 tgttcttgtaaccggaggaatatgtgcaacctcttcaccatgattggtgatgggtgaaggcgtggtaggttgtttgttctttcgagtagtatggcaaaca 30472673  T
201 ttggtgctaggacatagat 219  Q
    |||||||||||||||||||    
30472674 ttggtgctaggacatagat 30472692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University