View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12904_high_16 (Length: 224)
Name: NF12904_high_16
Description: NF12904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12904_high_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 136 - 207
Target Start/End: Complemental strand, 30083759 - 30083688
Alignment:
| Q |
136 |
caacaacgatgtttttgtgctttgttgaatttataaaataatatacatcaaataatgacctcaaaggttgct |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
30083759 |
caacaacgatgtttttgtgctttgttgaatttataaaataatatacatcaaataatgaactcaaagggtgct |
30083688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 22 - 116
Target Start/End: Complemental strand, 30084364 - 30084259
Alignment:
| Q |
22 |
gtgtttacaataatcattttttcttaaattatcttataataatgatgatgt-----------agatatggagatacaccaattatgtgatgaacatcact |
110 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30084364 |
gtgtttacaagaatcattttttcttaaattatcttataattttgatgatgttgttttgtaatagatatggagatacaccaattatgtgataaacatcact |
30084265 |
T |
|
| Q |
111 |
tatatg |
116 |
Q |
| |
|
|||||| |
|
|
| T |
30084264 |
tatatg |
30084259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University