View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12904_low_16 (Length: 237)
Name: NF12904_low_16
Description: NF12904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12904_low_16 |
 |  |
|
| [»] scaffold0417 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 9905298 - 9905518
Alignment:
| Q |
1 |
ttctcatgttacgtattttctctctatatcctctcatccccataaacctccaccaccaccacccacaaccgtttatcgccgccatcactaaagttttcat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9905298 |
ttctcatgttacgtattttctctctatatcctctcatccccgtaaacctccaccaccaccacccacaaccgtttatcgccgccatcactaaagttttcat |
9905397 |
T |
 |
| Q |
101 |
ctttgtgaagttcatcatttcagatctaatctaattcttatttgtgtttggttgtttttgattttgtagatttcaatggaatagtttatgacggtggtgg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
9905398 |
ctttgtgaagttcatcatttcagatctaatctaattcttatttgtgtttggttgtttttgattttgtagatttcaatggaatagtttatgatggcggtgg |
9905497 |
T |
 |
| Q |
201 |
cgagatgatgatgggaggaag |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
9905498 |
cgagatgatgatgggaggaag |
9905518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0417 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: scaffold0417
Description:
Target: scaffold0417; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 94 - 217
Target Start/End: Original strand, 9049 - 9172
Alignment:
| Q |
94 |
ttttcatctttgtgaagttcatcatttcagatctaatctaattcttatttgtgtttggttgtttttgattttgtagatttcaatggaatagtttatgacg |
193 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9049 |
ttttcatcactgtgaagttcattattttttatctaatctaattcttatttgtgtttgattgtttttgattttgtagattccaatggaatagtttatgacg |
9148 |
T |
 |
| Q |
194 |
gtggtggcgagatgatgatgggag |
217 |
Q |
| |
|
| || ||||||||||||||||||| |
|
|
| T |
9149 |
gcggcggcgagatgatgatgggag |
9172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 123 - 221
Target Start/End: Original strand, 17737234 - 17737332
Alignment:
| Q |
123 |
gatctaatctaattcttatttgtgtttggttgtttttgattttgtagatttcaatggaatagtttatgacggtggtggcgagatgatgatgggaggaag |
221 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| ||||| | |||||||||||||||||||| |
|
|
| T |
17737234 |
gatctaatctaattcagatttgtgtttggttgtttttgattttgtagatttcgatggaatagttttcgacggcaactgtgagatgatgatgggaggaag |
17737332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University