View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12904_low_17 (Length: 236)
Name: NF12904_low_17
Description: NF12904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12904_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 30472474 - 30472692
Alignment:
| Q |
1 |
aatattgttgtctttcaaatcattgaaggcacgggttttgcttttgaataatatggttctagttatgcataagttggaccagattattaagaatttcacc |
100 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |||||||||||| || ||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30472474 |
aatattgttgtcttttaaatcgttgaaggcacgagttttgctcttgaataatatgtttatagttatgcataagttggaccagattactaagaatttcacc |
30472573 |
T |
 |
| Q |
101 |
agttcttgtaaccggaggaatatgtgcaacctcttcaccatgattggtgatgggtgaaggcgtggtaggtcgtttgttctttcgagtagtatggcaaaca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30472574 |
tgttcttgtaaccggaggaatatgtgcaacctcttcaccatgattggtgatgggtgaaggcgtggtaggttgtttgttctttcgagtagtatggcaaaca |
30472673 |
T |
 |
| Q |
201 |
ttggtgctaggacatagat |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
30472674 |
ttggtgctaggacatagat |
30472692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University