View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12906_high_5 (Length: 290)
Name: NF12906_high_5
Description: NF12906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12906_high_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 46; Significance: 3e-17; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 114 - 171
Target Start/End: Complemental strand, 3893528 - 3893471
Alignment:
| Q |
114 |
gttctagaagtaattcgaattttacctcagaaattaggactctaggtgttggattaaa |
171 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3893528 |
gttctagaagtaattcttattttacctcagaaattaggattctaggtgttggattaaa |
3893471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 233 - 274
Target Start/End: Complemental strand, 3893409 - 3893368
Alignment:
| Q |
233 |
ggtgttgttctcacttgttgttgatggtggtgtagtgattag |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3893409 |
ggtgttgttctcacttgttgttgatggtggtgtagtgattag |
3893368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 11 - 50
Target Start/End: Complemental strand, 3893630 - 3893591
Alignment:
| Q |
11 |
cataggtgtcattgaagatgatgatagatgaatgagagag |
50 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3893630 |
cataggtgtcattgaagatgatgataggtgaatgagagag |
3893591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 114 - 171
Target Start/End: Original strand, 4295545 - 4295602
Alignment:
| Q |
114 |
gttctagaagtaattcgaattttacctcagaaattaggactctaggtgttggattaaa |
171 |
Q |
| |
|
||||||| ||||||||||||||||| | ||||||| || |||||||||||||||||| |
|
|
| T |
4295545 |
gttctaggagtaattcgaattttacttaagaaattgcgattctaggtgttggattaaa |
4295602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University