View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12907_high_6 (Length: 209)
Name: NF12907_high_6
Description: NF12907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12907_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 161 - 195
Target Start/End: Original strand, 7501847 - 7501881
Alignment:
| Q |
161 |
aagggaaaaagggaggcggaggccacttatctgtg |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
7501847 |
aagggaaaaagggaggcggaggccacttatctgtg |
7501881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 18 - 75
Target Start/End: Complemental strand, 27257852 - 27257795
Alignment:
| Q |
18 |
cttttgagttggatcgattacaatccaacttaacttcaaattctcttgcaagtattca |
75 |
Q |
| |
|
|||| ||||||||||||| |||| |||||| ||| ||||||| |||||||| |||||| |
|
|
| T |
27257852 |
ctttcgagttggatcgataacaacccaactcaacctcaaattttcttgcaaatattca |
27257795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University