View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12909_low_18 (Length: 235)
Name: NF12909_low_18
Description: NF12909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12909_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 146 - 225
Target Start/End: Original strand, 14259578 - 14259657
Alignment:
| Q |
146 |
ctggataagtttgtatcgatttgaagatataatcgggatgctggctaaagttgaggttgaagatgaatatatttttgatg |
225 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14259578 |
ctggataaatttgtatcgatttgaagatataatcgggatgctggctaaagttgaggttgaagatgaatatatttttgatg |
14259657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 18 - 87
Target Start/End: Original strand, 14259450 - 14259519
Alignment:
| Q |
18 |
attttttgacccatccttcagtttttctttcaaatatttacaaatctgaagttatggttggggagttacg |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14259450 |
attttttgacccatccttcagtttttctttcaaatatttacaaatctgaagttatggttggggagttacg |
14259519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 20 - 75
Target Start/End: Complemental strand, 6604684 - 6604629
Alignment:
| Q |
20 |
tttttgacccatccttcagtttttctttcaaatatttacaaatctgaagttatggt |
75 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||| |||||| | |||||||||||| |
|
|
| T |
6604684 |
ttttttacccatccttcggtttttctttcaaatagttacaattatgaagttatggt |
6604629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University