View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1290_high_10 (Length: 317)

Name: NF1290_high_10
Description: NF1290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1290_high_10
NF1290_high_10
[»] chr4 (1 HSPs)
chr4 (127-176)||(38028494-38028543)


Alignment Details
Target: chr4 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 127 - 176
Target Start/End: Complemental strand, 38028543 - 38028494
Alignment:
127 cttcataagagaaaatcaacacacaaacaagattgaagataaacaataga 176  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||    
38028543 cttcataagtgaaaatcaacacacaaacaagattgaagataaacaataga 38028494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University