View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1290_low_19 (Length: 330)
Name: NF1290_low_19
Description: NF1290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1290_low_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 105 - 220
Target Start/End: Original strand, 30319666 - 30319782
Alignment:
| Q |
105 |
cacagacaccattggaaatgacccatttgcttcctaatcatnnnnnnncaatctttttcaatttttaacactacccac-nnnnnnnntcagctagatcca |
203 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30319666 |
cacaggcaccattggaaatgacccatttgcttcctaatcataaaaaaacaatccttttcaatttttaacactacccacaaaaaaaaatcagctagatcca |
30319765 |
T |
|
| Q |
204 |
tgaattaaattcaaaag |
220 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
30319766 |
tgaattaaattcaaaag |
30319782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University