View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1291-Insertion-2 (Length: 199)
Name: NF1291-Insertion-2
Description: NF1291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1291-Insertion-2 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 5e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 5e-98
Query Start/End: Original strand, 8 - 199
Target Start/End: Complemental strand, 29457470 - 29457278
Alignment:
| Q |
8 |
ataagctattaaatgacaaagttatgctaattagctttaatttcaagtgacttaaaataatagaaattggtttttt-agtcaaaattaagtgtatgtaac |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29457470 |
ataagctattaaatgacaaagttatgctaattagctttaatttcaagtgacttaaaataatagaaattggtttttttagtcaaaattaagtgtatgtaac |
29457371 |
T |
|
| Q |
107 |
atgttaacttactctttagtgtttttagatgcatgtaaattagcaatcatatacatgaatcttttgctctagagtgttgcccctgttgactaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29457370 |
atgttaacttactctttagtgtttttagattcatgtaaattagcaatcatatacatgaatcttttgctctagagtgttgcccctgttgactaa |
29457278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 80 - 152
Target Start/End: Complemental strand, 13198910 - 13198838
Alignment:
| Q |
80 |
ttttagtcaaaattaagtgtatgtaacatgttaacttactctttagtgtttttagatgcatgtaaattagcaa |
152 |
Q |
| |
|
|||| ||||||| |||||| ||||| |||||||||| |||||| ||||||||| || ||||||||||||| |
|
|
| T |
13198910 |
ttttggtcaaaaataagtggatgtagattgttaacttagtctttaatgtttttaggtgtgtgtaaattagcaa |
13198838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University