View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1291-Insertion-7 (Length: 331)
Name: NF1291-Insertion-7
Description: NF1291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1291-Insertion-7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 51; Significance: 3e-20; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 8 - 185
Target Start/End: Complemental strand, 31607067 - 31606901
Alignment:
| Q |
8 |
atctctcccactttgaaaggcgctccctcccgtttaaacctgtcca-cccatccataaagaaccctgcaccctccagcatgtgaatttatgtttattttg |
106 |
Q |
| |
|
||||||||||||| ||||||||||| ||||| ||||||||||| ||||||||||| |||||||||||| | |||||||||||| ||||| |||| |
|
|
| T |
31607067 |
atctctcccacttgaaaaggcgctcct--ccgttaaaacctgtccaacccatccataa-gaaccctgcacctccaagcatgtgaatt-atgtta--tttg |
31606974 |
T |
|
| Q |
107 |
gtggaaaattttgtctatcattttgaggtttcttgggaccaaccctgcccatttcatcaacattaatcagaagtttaat |
185 |
Q |
| |
|
||||||||||||||||||||||| || ||||| ||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
31606973 |
gtggaaaattttgtctatcatttgaag--ttctt-ggaccaa-cctgcc--attcatcaacattaatcagaagtttaat |
31606901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 282 - 331
Target Start/End: Complemental strand, 31606867 - 31606818
Alignment:
| Q |
282 |
gcaaaattttacttgaatttgtaaagttttgaaataaaccataattttag |
331 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31606867 |
gcaaaattttacttgagcttgtaaagttttgaaataaaccataattttag |
31606818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University