View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12910_high_12 (Length: 244)

Name: NF12910_high_12
Description: NF12910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12910_high_12
NF12910_high_12
[»] chr8 (3 HSPs)
chr8 (18-220)||(41127030-41127232)
chr8 (140-204)||(26506761-26506825)
chr8 (134-210)||(26494710-26494786)
[»] chr2 (7 HSPs)
chr2 (38-204)||(2327023-2327189)
chr2 (38-201)||(2303468-2303631)
chr2 (38-177)||(2293855-2293994)
chr2 (38-196)||(2321169-2321328)
chr2 (38-221)||(2351044-2351227)
chr2 (38-177)||(2310186-2310325)
chr2 (38-221)||(2330738-2330921)


Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 18 - 220
Target Start/End: Original strand, 41127030 - 41127232
Alignment:
18 atgaagagaataaggaaattaaagaggaagacttgcagaacctaccatatctaaagtgtgtgattttggaagggctgaggcgtcacccaccggggcactt 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
41127030 atgaagagaataaggaaattaaagaggaagacttgcagaacctaccatatctaaagtgtgtgattttggaagggctgaggtgtcacccaccggggcactt 41127129  T
118 tgtgttgccccatgcggtgaaggaggatgtggttttcaacggttacttgctgcctaaaaatgcggtagtgaatttcatggtggcagacatagggagggac 217  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
41127130 tgtgttgccccatgcggtgaaggaggatgtggttttcgacggttacttgctgcctaaaaatgtggtagtgaatttcatggtggcagacatagggagggac 41127229  T
218 cct 220  Q
    |||    
41127230 cct 41127232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 140 - 204
Target Start/End: Original strand, 26506761 - 26506825
Alignment:
140 gaggatgtggttttcaacggttacttgctgcctaaaaatgcggtagtgaatttcatggtggcaga 204  Q
    ||||||||| |||| |||||||||||| |||||||||||| |  ||| ||||| |||||||||||    
26506761 gaggatgtgatttttaacggttacttggtgcctaaaaatgggacagttaattttatggtggcaga 26506825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 134 - 210
Target Start/End: Original strand, 26494710 - 26494786
Alignment:
134 gtgaaggaggatgtggttttcaacggttacttgctgcctaaaaatgcggtagtgaatttcatggtggcagacatagg 210  Q
    |||| ||||||| | ||||| || ||||||||| |||||||||||| |   |||||||| ||||||||||| |||||    
26494710 gtgacggaggatattgttttgaatggttacttggtgcctaaaaatgggactgtgaattttatggtggcagatatagg 26494786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 67; Significance: 7e-30; HSPs: 7)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 38 - 204
Target Start/End: Original strand, 2327023 - 2327189
Alignment:
38 aaagaggaagacttgcagaacctaccatatctaaagtgtgtgattttggaagggctgaggcgtcacccaccggggcactttgtgttgccccatgcggtga 137  Q
    ||||||||||||||||| || || |  ||| | ||||||||| ||||||||||| |||||||||| ||||| ||||| ||||||||||| ||||| ||||    
2327023 aaagaggaagacttgcataaacttcggtatttgaagtgtgtggttttggaagggttgaggcgtcatccaccagggcattttgtgttgcctcatgcagtga 2327122  T
138 aggaggatgtggttttcaacggttacttgctgcctaaaaatgcggtagtgaatttcatggtggcaga 204  Q
      || ||||||||||| || ||||| ||| |||||||||||| |   ||||||||||||||||||||    
2327123 gcgatgatgtggttttgaatggttatttggtgcctaaaaatgggacggtgaatttcatggtggcaga 2327189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 38 - 201
Target Start/End: Original strand, 2303468 - 2303631
Alignment:
38 aaagaggaagacttgcagaacctaccatatctaaagtgtgtgattttggaagggctgaggcgtcacccaccggggcactttgtgttgccccatgcggtga 137  Q
    ||||||||||| |||||||| || |  ||| | || |||||  ||||||||||| |||||||||| ||||||||||| ||| ||||||| || |||||||    
2303468 aaagaggaagaattgcagaaacttcggtatttgaaatgtgttgttttggaagggttgaggcgtcatccaccggggcattttctgttgccacacgcggtga 2303567  T
138 aggaggatgtggttttcaacggttacttgctgcctaaaaatgcggtagtgaatttcatggtggc 201  Q
    | |||||||||||||| |||||||| ||| |||||||||||| |   |||||||||||| ||||    
2303568 aagaggatgtggttttgaacggttatttggtgcctaaaaatgggacggtgaatttcatgctggc 2303631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 38 - 177
Target Start/End: Original strand, 2293855 - 2293994
Alignment:
38 aaagaggaagacttgcagaacctaccatatctaaagtgtgtgattttggaagggctgaggcgtcacccaccggggcactttgtgttgccccatgcggtga 137  Q
    |||||||||||||||||||| || |  ||| | ||||||||| ||||||||||| |||||||||| ||||||||| | |||  |||||| || |||||||    
2293855 aaagaggaagacttgcagaaacttcggtatttgaagtgtgtggttttggaagggttgaggcgtcatccaccggggaaatttccgttgccacacgcggtga 2293954  T
138 aggaggatgtggttttcaacggttacttgctgcctaaaaa 177  Q
    | ||||||||||||||  ||||||| ||| ||||||||||    
2293955 aagaggatgtggttttggacggttatttggtgcctaaaaa 2293994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 38 - 196
Target Start/End: Original strand, 2321169 - 2321328
Alignment:
38 aaagaggaagacttgcagaacctaccatatctaaagtgtgtgattttggaagggctgaggcgtcacccacc-ggggcactttgtgttgccccatgcggtg 136  Q
    ||||||||| |||||||||| || | |||| | ||||| ||| ||||||||||| |||||||||| ||||| |||||| ||||||||| | ||  |||||    
2321169 aaagaggaaaacttgcagaaacttcgatatttgaagtgcgtggttttggaagggatgaggcgtcatccaccaggggcattttgtgttggcacacacggtg 2321268  T
137 aaggaggatgtggttttcaacggttacttgctgcctaaaaatgcggtagtgaatttcatg 196  Q
    || |||||||||||||| |||||||| ||| |||||||||||| |   ||||||||||||    
2321269 aaagaggatgtggttttgaacggttatttggtgcctaaaaatgggacggtgaatttcatg 2321328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 38 - 221
Target Start/End: Original strand, 2351044 - 2351227
Alignment:
38 aaagaggaagacttgcagaacctaccatatctaaagtgtgtgattttggaagggctgaggcgtcacccaccggggcactttgtgttgccccatgcggtga 137  Q
    ||||||||||| |||||||| ||    ||||| || |||||| ||||||||||| |||||||||| |||||||||||   ||||||||| || |||||||    
2351044 aaagaggaagatttgcagaaacttttgtatctgaaatgtgtggttttggaagggttgaggcgtcatccaccggggcataatgtgttgccacacgcggtga 2351143  T
138 aggaggatgtggttttcaacggttacttgctgcctaaaaatgcggtagtgaatttcatggtggcagacatagggagggaccctc 221  Q
      ||||||||| |||| |||||||| ||| |||||||||||| |   || ||||| ||||||||||| || ||| |||| ||||    
2351144 cagaggatgtgctttttaacggttatttggtgcctaaaaatgggacggtcaattttatggtggcagagatggggtgggatcctc 2351227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 38 - 177
Target Start/End: Original strand, 2310186 - 2310325
Alignment:
38 aaagaggaagacttgcagaacctaccatatctaaagtgtgtgattttggaagggctgaggcgtcacccaccggggcactttgtgttgccccatgcggtga 137  Q
    |||||||||||||||||||| ||    ||| | ||||||||| ||||||||||| |||||||||| ||| ||||| | |||  |||||| || |||||||    
2310186 aaagaggaagacttgcagaaactttggtatttgaagtgtgtggttttggaagggttgaggcgtcatccatcggggaaatttccgttgccacacgcggtga 2310285  T
138 aggaggatgtggttttcaacggttacttgctgcctaaaaa 177  Q
    | ||||||||||||||  ||||||| ||| ||||||||||    
2310286 aagaggatgtggttttggacggttatttggtgcctaaaaa 2310325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 38 - 221
Target Start/End: Original strand, 2330738 - 2330921
Alignment:
38 aaagaggaagacttgcagaacctaccatatctaaagtgtgtgattttggaagggctgaggcgtcacccaccggggcactttgtgttgccccatgcggtga 137  Q
    ||||||||||||||||| || || |  ||| | ||||| ||| ||||||||||| |||||||||| ||||| ||||| || |||||||| || || ||||    
2330738 aaagaggaagacttgcataaacttcggtatttgaagtgcgtggttttggaagggttgaggcgtcatccaccagggcatttcgtgttgcctcacgcagtga 2330837  T
138 aggaggatgtggttttcaacggttacttgctgcctaaaaatgcggtagtgaatttcatggtggcagacatagggagggaccctc 221  Q
      |||||||||||||| || ||||| ||| |||||||| ||| |   |||||||| ||||| ||||| || |||  ||||||||    
2330838 gcgaggatgtggttttgaatggttatttggtgcctaaagatgggacggtgaattttatggttgcagagatggggttggaccctc 2330921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University