View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12910_low_11 (Length: 324)
Name: NF12910_low_11
Description: NF12910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12910_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 14 - 305
Target Start/End: Complemental strand, 38620801 - 38620506
Alignment:
| Q |
14 |
tactttcatgattatgcaaatgttagaccttgatgcagcaagtatgtcatgtggatgagcct----ttctatcactatgctttgtgttccaaagatattt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
38620801 |
tactttcatgattatgcaaatgttagaccttgatgcagcaagtatgtcatgtggatgagcctgcctttctatcactatgcattgtgttccaaagatattt |
38620702 |
T |
 |
| Q |
110 |
aatgcatgtatggaattggcggtgaatttgacaaaatcacaatgctaaattgtgaatccgacagattcactgtcaatccaaatgtgcacttatacacttg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| |||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38620701 |
aatgcatgtatggaattggcggtgaatttgacaaaatcacagtgctacattgtgattccgacagattcaccgtcaatccaaatgtgcacttatacacttg |
38620602 |
T |
 |
| Q |
210 |
ctttgttaacattttcccatttaattaaaacacgggtctagtagcccgagtctcttattaaactcaaattgaaaacaatatactgctaatgccggg |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38620601 |
ctttgttaacattttcccatttaattaaaacacgggtctagtagcccgagtctcttattaaactcaaattgaaaacaatatactgctaatgccggg |
38620506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University