View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12910_low_6 (Length: 453)
Name: NF12910_low_6
Description: NF12910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12910_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-122; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-122
Query Start/End: Original strand, 49 - 445
Target Start/End: Original strand, 27712370 - 27712768
Alignment:
| Q |
49 |
tttgggttggttttgagctagaccgagttacggtactgcatcatcgtttgactgccttagttatttggtttttgatttattgaggactatcgcttttgtt |
148 |
Q |
| |
|
||||||||| ||||||| | |||| | || || || ||||||||| ||||||| |||||| ||||||||||||| || | |||| | |||||||||||| |
|
|
| T |
27712370 |
tttgggttgtttttgagttggaccaaattgcgccaccgcatcatcggttgactgtcttagtgatttggtttttgaattctagaggtcaatcgcttttgtt |
27712469 |
T |
|
| Q |
149 |
ttgaggtcagatgttagtgtttaattgcaagtttttgggctggttatggtgtcttttacgttatgccgagagtttaggggtgccttagtgatttgttttc |
248 |
Q |
| |
|
||||| || |||||||||||||||||||| |||| |||| ||||||||||||||||||||||| |||||||||||||||| |||| ||||||||||||| |
|
|
| T |
27712470 |
ttgagatcggatgttagtgtttaattgcaggtttctgggttggttatggtgtcttttacgttagaccgagagtttaggggtcccttggtgatttgttttc |
27712569 |
T |
|
| Q |
249 |
ggagtctggtggaccgattgannnnnnnnnnnnnnn--agatagcgagaaagcttctagactcaagtttttgggcatattatgatgtcttaaccaacaaa |
346 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27712570 |
ggagtctggtggaccgattgattttttattttatttttagatagcgagaaagcttctatactcaagtttttgggcatattatgatgtcttaaccagcaaa |
27712669 |
T |
|
| Q |
347 |
cgagagttagattggtggtggaatccaaatgagcttggaataagagattttcgggtttttacttgggctcaattgtgtgaagaaaaagtgtgatgatgt |
445 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27712670 |
cgagagttagattggtggtggaatccgaatgagcttggaataagagattttcgggtttttacttgggctcaattgtgtgaagaaaaggtgtgatgatgt |
27712768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 232 - 266
Target Start/End: Complemental strand, 51065931 - 51065897
Alignment:
| Q |
232 |
cttagtgatttgttttcggagtctggtggaccgat |
266 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
51065931 |
cttagtgatttgttttgggagtctggtggaccgat |
51065897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 218 - 266
Target Start/End: Original strand, 12883568 - 12883616
Alignment:
| Q |
218 |
gagtttaggggtgccttagtgatttgttttcggagtctggtggaccgat |
266 |
Q |
| |
|
||||| |||||||||||| | |||||||| |||||||||||||||||| |
|
|
| T |
12883568 |
gagttgaggggtgccttaataatttgtttatggagtctggtggaccgat |
12883616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University