View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12911_high_10 (Length: 256)
Name: NF12911_high_10
Description: NF12911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12911_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 22 - 250
Target Start/End: Original strand, 28741966 - 28742194
Alignment:
| Q |
22 |
accgctaatacgaagagattcacgtaccaaaaaccctattcacaacaagcttaacctcgattttgagcctaatcaacgacgatagaactaccggtgcagt |
121 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| || |
|
|
| T |
28741966 |
accgctaatacgaatagattcacgtaccaaaaaccctattcacaacaagcttaacctcgactttgagcctaatcaacgacgatagaactaccggtgcggt |
28742065 |
T |
 |
| Q |
122 |
gatggcaactgaaacacctcttgcaaacagcaaatctcaacatatctaaaaagaaccaaagatcaaaggcaagaaaaaacaaccaacacacggaagcagc |
221 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28742066 |
gatggcaactgaaacacctcttgcaaacaacgaatctcaacatatctaaaaagaaccaaagatcaaaggcaagaaaaaacaaccaacacacgtaagcagc |
28742165 |
T |
 |
| Q |
222 |
aacaccttccaagacgaaccctatgcttc |
250 |
Q |
| |
|
|||||||||||||||||||||||| |||| |
|
|
| T |
28742166 |
aacaccttccaagacgaaccctatccttc |
28742194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University