View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12911_high_4 (Length: 470)
Name: NF12911_high_4
Description: NF12911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12911_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 8e-93; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 8e-93
Query Start/End: Original strand, 11 - 258
Target Start/End: Complemental strand, 9472348 - 9472099
Alignment:
| Q |
11 |
cacagacaaatacccccaaacgttgtttcactctcttcacttcaactactgtcactgtttttctcttccatannnnnnnnc--aaggatcttcattttca |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9472348 |
cacagacaaatacccccaaacgttgtttcactctcttcacttcaactactgtcactgtttttctcttccatatttttttttttaaggatcttcattttca |
9472249 |
T |
 |
| Q |
109 |
tgcccttcttcttctaggatcttccatttttttgtgggttgtgtttgannnnnnnnnncattgaagacaatgaagttttctgaggagaagaatgtttcta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
9472248 |
tgcccttcttcttctaggatcttccatttttttgtgggttgtgtttgattttttttttcattgaagaaaatgaagttttctgtggagaagaatgtttcta |
9472149 |
T |
 |
| Q |
209 |
acaaccccacaaattttgaaggtttgataatgattttcatggttaatggg |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9472148 |
acaaccccacaaattttgaaggtttgataatgattttcatggttaatggg |
9472099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 346 - 455
Target Start/End: Complemental strand, 9472019 - 9471910
Alignment:
| Q |
346 |
gtgataataggagggttagattctagaaaggttgggcaaaacagaagagcattgggtgtgattaatcagaatttggttgtggaaggacgtccttatcctt |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9472019 |
gtgataataggagggttagattctagaaaggttgggcaaaacagaagagcattgggtgtgattaatcagaatttggttgtggaaggacgtccttatcctt |
9471920 |
T |
 |
| Q |
446 |
gtgttgttaa |
455 |
Q |
| |
|
|||||||||| |
|
|
| T |
9471919 |
gtgttgttaa |
9471910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University