View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12912_high_9 (Length: 251)
Name: NF12912_high_9
Description: NF12912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12912_high_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 3e-57; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 77 - 189
Target Start/End: Complemental strand, 46751404 - 46751292
Alignment:
| Q |
77 |
ggacaatgtttgtaatactgacagtcttacagagcagtcagttagaaacaaatgtctgattacatagcacatcaaaactgaacccaaagccttgttggat |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46751404 |
ggacaatgtttgtaatactgacagtcttacagagcagtcagttagaaacaaatgtctgattacatagcacatcaaaactgaacccaaagccttgttggat |
46751305 |
T |
|
| Q |
177 |
tttgtttgatgct |
189 |
Q |
| |
|
||||||||||||| |
|
|
| T |
46751304 |
tttgtttgatgct |
46751292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University