View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12912_low_8 (Length: 286)
Name: NF12912_low_8
Description: NF12912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12912_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 14 - 202
Target Start/End: Complemental strand, 3522133 - 3521947
Alignment:
| Q |
14 |
ttctgttgtcttttcttttccttctgataacaaaagaacattactttgtgatagaataaaataagaataccaccttcattcatttgttcgttccctagca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||| | || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3522133 |
ttctgttgtcttttcttttccttctgataaaataa--acattactttgtgatagaataaaataagaataccaccttcattcatttgttcgttccctagca |
3522036 |
T |
 |
| Q |
114 |
acatgattcattaacaaaattgaacatttaattaatcagtaaggtgcaggctgcccctcttagctgatatcatgtgtgtcctttagttt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3522035 |
acatgattcattaacaaaattgaacatttaattaatcagttaggtgcaggatgcccctcttagctgatatcatgtgtgtcgtttagttt |
3521947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 217 - 267
Target Start/End: Complemental strand, 3521820 - 3521770
Alignment:
| Q |
217 |
aatgttactatatgattcagcatcgtcttcgtgtgcttattccaccagtta |
267 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3521820 |
aatgttactatatgaatcagcatcgtcttcgtgtgcttattccaccagtta |
3521770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University