View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12913_high_29 (Length: 343)
Name: NF12913_high_29
Description: NF12913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12913_high_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 19 - 328
Target Start/End: Complemental strand, 7646055 - 7645749
Alignment:
| Q |
19 |
gtgaagggatgtgatgtctcattcctttggagaagggtatgctacgaggtctgatgaagaaggatttggagggatatatagtggaaaccaatcccttcag |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7646055 |
gtgaagggatgtgatgtctcattcctttggagaagggtatgctacaaggtctgatgaagaaggatttggagggatatatggtggaaaccaatcccttcag |
7645956 |
T |
|
| Q |
119 |
aaagataagtccgtccatgaaaatcacccaggttataattagttaatttgcttatgatcatacatggacaactagnnnnnnnccttacgtttaaaacatt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7645955 |
aaagataagtccgtccatgaaaatcacccaggttataattagttaatttgcttatgatcatacatggacaactagtttttttccttacgtttaaaacatt |
7645856 |
T |
|
| Q |
219 |
ttacaccgtcaatttcttattacttttgtagaggtcatgatggaaattaattattaagcctaattcagacttgtttgtttttgtgcatgaagattatgac |
318 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7645855 |
ttacaccgtcattttcttattacttttgtagaggtc---atggaaattaattattaagcctaattaagacttgtttgtttttgtgcatgaagattatgac |
7645759 |
T |
|
| Q |
319 |
aagacacagg |
328 |
Q |
| |
|
|||||||||| |
|
|
| T |
7645758 |
aagacacagg |
7645749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University