View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12913_high_34 (Length: 307)
Name: NF12913_high_34
Description: NF12913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12913_high_34 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 1 - 178
Target Start/End: Original strand, 38332358 - 38332535
Alignment:
| Q |
1 |
taaaaaataggacagacttaggataatattattttgggattaagcaacaaaaaatgtggtgcagttagcaagctccacttaggagaatattattattttt |
100 |
Q |
| |
|
|||||||||| | |||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
38332358 |
taaaaaatagtatagacttgggataatattatttagggattaagcaacaaaaaatgtggtgcagttagcaagatccacttaggataatattattattttt |
38332457 |
T |
 |
| Q |
101 |
gcatgctttataacatattatgttagtgtgtgcttggttatgcggggaagaaaattgattttaggtgtaaaattgatt |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38332458 |
gcatgctttataacatattatgttagtgtgtgcttggttatgcggggaagaaaattgattttaggtgtaaaattgatt |
38332535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 208 - 290
Target Start/End: Original strand, 38332956 - 38333039
Alignment:
| Q |
208 |
tggttgaactttttggttcatgtttggaactccgacattggttgtttattgt-aaatccttgctgacattgcttgtgattctct |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38332956 |
tggttgaactttttggttcatgtttggaactccgacattggttgtttattgtaaaatccttgctgacattgcttgtgattctct |
38333039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University