View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12913_high_49 (Length: 237)
Name: NF12913_high_49
Description: NF12913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12913_high_49 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 105 - 237
Target Start/End: Original strand, 7645640 - 7645772
Alignment:
| Q |
105 |
tctaactgcaaatacatgtgtttattgcataaaccactacacacaagaaaaacctaagcatttgcgctgctctggtgcctagctttttccttctctttca |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7645640 |
tctaactgcaaatacatgtgtttattgcataaaccactacacacaagaaaaacctaagcattggcgctgctctggtgcctagctttttccttctctttca |
7645739 |
T |
 |
| Q |
205 |
cctcgcttccctgtgtcttgtcataatcttcat |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
7645740 |
cctcgcttccctgtgtcttgtcataatcttcat |
7645772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 13 - 48
Target Start/End: Original strand, 7645548 - 7645583
Alignment:
| Q |
13 |
atacttatacataattgtccatattatcactctgag |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
7645548 |
atacttatacataattgtccatattatcactctgag |
7645583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University