View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12913_high_52 (Length: 222)
Name: NF12913_high_52
Description: NF12913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12913_high_52 |
 |  |
|
| [»] scaffold0219 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0219 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: scaffold0219
Description:
Target: scaffold0219; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 14 - 134
Target Start/End: Complemental strand, 10845 - 10725
Alignment:
| Q |
14 |
attattcttgcaagcttccacaccttgatcataaacttgtctgagtttgatgcaaactgaatcccctttgatgcaaggtttaagtaattgcatgaaaaag |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10845 |
attattcttgcaagcttccacaccttgatcataaacttgtctgagtttgatgcaaactgaatcccctttgatgcaaggtttaagtaattgcatgaaaaag |
10746 |
T |
 |
| Q |
114 |
agatcatcaaaattaacaagg |
134 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
10745 |
agatcatcaaaattaacaagg |
10725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 29 - 136
Target Start/End: Complemental strand, 15697916 - 15697808
Alignment:
| Q |
29 |
ttccacaccttgatcataaa-cttgtctgagtttgatgcaaactgaatcccctttgatgcaaggtttaagtaattgcatgaaaaagagatcatcaaaatt |
127 |
Q |
| |
|
|||||||||| ||| |||| ||||| ||||||| ||||||||||| ||||||||||||||| |||| |||||| |||||| | | |||||||||||||| |
|
|
| T |
15697916 |
ttccacacctcgattataagtcttgtgtgagtttaatgcaaactgagtcccctttgatgcaaagtttcagtaatagcatgagagatagatcatcaaaatt |
15697817 |
T |
 |
| Q |
128 |
aacaagggc |
136 |
Q |
| |
|
|||||||| |
|
|
| T |
15697816 |
tacaagggc |
15697808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 18 - 153
Target Start/End: Complemental strand, 18711333 - 18711195
Alignment:
| Q |
18 |
ttcttgcaagcttccacaccttgatcataaactt---gtctgagtttgatgcaaactgaatcccctttgatgcaaggtttaagtaattgcatgaaaaaga |
114 |
Q |
| |
|
||||||||| |||||||||| |||||||||||| || ||||||| ||||||| |||||||||||||||||| ||||| |||||| |||| || |
|
|
| T |
18711333 |
ttcttgcaaccttccacaccgcgatcataaacttcttgtatgagtttaatgcaaattgaatcccctttgatgcagggtttcgataattgagtgaaggcga |
18711234 |
T |
 |
| Q |
115 |
gatcatcaaaattaacaagggcttgtgcgaaagaacaag |
153 |
Q |
| |
|
|||||| | |||||| || ||||||||||| ||||||| |
|
|
| T |
18711233 |
gatcattagaattaaatagagcttgtgcgaaggaacaag |
18711195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University