View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12913_high_53 (Length: 217)
Name: NF12913_high_53
Description: NF12913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12913_high_53 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 16 - 202
Target Start/End: Original strand, 41998571 - 41998757
Alignment:
| Q |
16 |
gaaggaaaggaagggaggatatacagcgagggatttccccggagatacctttccaatcggcgacggtgaagctcgagagacggttgaggtgacagattgc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41998571 |
gaaggaaaggaagggaggatatacagcgagggatttcgccggagatacctttccaatcggcgacggtgaagctcgagagacggttgaggtgacagattgc |
41998670 |
T |
|
| Q |
116 |
tggtgagatgtaaccggtcatgtaaccggtacggtggtgnnnnnnnnggaagattggatcttctgactcgccgcggaggttgatatc |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41998671 |
tggtgagatgtaaccggtcatgtaaccggtacggtggtgttttttttggaagattggatcttctgactcgccgcggaggttgatatc |
41998757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 167 - 199
Target Start/End: Complemental strand, 8822334 - 8822302
Alignment:
| Q |
167 |
gattggatcttctgactcgccgcggaggttgat |
199 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
8822334 |
gattggatcttctgactcgccacggaggttgat |
8822302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University