View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12913_low_13 (Length: 458)
Name: NF12913_low_13
Description: NF12913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12913_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 255; Significance: 1e-142; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 20 - 336
Target Start/End: Complemental strand, 10104465 - 10104160
Alignment:
| Q |
20 |
ggaaatacatccacatgagtagataggaatttgcttaatgacaacttgatgaatagagtagcaatttttatcaaaaatacatccacatttgttttgctct |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10104465 |
ggaaatacatccacatgagtagataggaatttgcttaatgacaacttgatgaatagagtagcaatttttatcaaaaatacatccacatttgttttgctct |
10104366 |
T |
|
| Q |
120 |
atgatctaacgacacttacattgcggatctgacacattaactgacatgtggctgctaagttgtgccaacgtgtcagagatacaatttgatgaagacgaaa |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10104365 |
atgatctaacgacacttacattgcggatctgacacattaactgacatgtggctgctaagttgtgccaacgtgtcagagatacaatttgatgaagacgaac |
10104266 |
T |
|
| Q |
220 |
ataaatcatgcagaaacgcggggagatgaggacaatatgtgcaaactacactatcaaaatattttagactttcaatccataaagatttggtacttcaaaa |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||| || | |||| |||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10104265 |
ataaatcatgcagaaacgcggggagatgagaacga-----------tacagtatcaaaatattttagactttcaatctataaagatttggtacttcaaaa |
10104177 |
T |
|
| Q |
320 |
cgtttagctattttcaa |
336 |
Q |
| |
|
|||| |||||||||||| |
|
|
| T |
10104176 |
cgttcagctattttcaa |
10104160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 410 - 448
Target Start/End: Complemental strand, 10104094 - 10104056
Alignment:
| Q |
410 |
gtaaaagtaagacatttcaaaactagtgtaaatattcat |
448 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10104094 |
gtaaaagtaagacttttcaaaactagtgtaaatattcat |
10104056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University