View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12913_low_40 (Length: 275)
Name: NF12913_low_40
Description: NF12913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12913_low_40 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 259
Target Start/End: Original strand, 37187907 - 37188166
Alignment:
| Q |
1 |
ttgcacattaattgtatggctggctattgggtatacagcatttcatgcacaaccgcgtgtgatgatatcatttgggtgggcatccacctataccaaatcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37187907 |
ttgcacattaattgtatggctggctattgggtatacagcatttcatgcacaaccgcgtgtgatgatatcatttgggtgggcatccacctataccaaatcc |
37188006 |
T |
|
| Q |
101 |
aaccatgcctttactttacccactcctcattcctcaccaactttcaacaccccatactatatcttcaattgaaccttcttgtaactttcctttc-ttttg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37188007 |
aaccatgcctttactttacccactcctcattcctcaccaactttcaacaccccatactatatcttcaattgaaccttcttgtaactttcctttctttttg |
37188106 |
T |
|
| Q |
200 |
caccctaaaccctataaataccttgccattcttccaaaatatcacaatccatcaacattc |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37188107 |
caccctaaaccctataaataccttgccattcttccaaaatatcacaatccatcaacattc |
37188166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 4 - 125
Target Start/End: Original strand, 53491938 - 53492053
Alignment:
| Q |
4 |
cacattaattgtatggctggctattgggtatacagcatttcatgcacaaccgcgtgtgatgatatcatttgggtgggcatccacctataccaaatccaac |
103 |
Q |
| |
|
|||||||| ||| || ||||||| ||||||||||||||||||||||||| || ||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
53491938 |
cacattaaatgtgtgactggctaatgggtatacagcatttcatgcacaaacgtgtgtgatgatatcatttgggtgggcat-----tataccaaa-ccaac |
53492031 |
T |
|
| Q |
104 |
catgcctttactttacccactc |
125 |
Q |
| |
|
|||| ||||||||||||||||| |
|
|
| T |
53492032 |
catgtctttactttacccactc |
53492053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University