View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12913_low_45 (Length: 251)

Name: NF12913_low_45
Description: NF12913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12913_low_45
NF12913_low_45
[»] chr3 (1 HSPs)
chr3 (1-233)||(38332140-38332372)


Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 38332372 - 38332140
Alignment:
1 ctatactattttttatgattaagaaacataaaaggaaatgaattgaagaaatacagaccctggcttgacgaagagcatcatgagagtcaggagcagaagg 100  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
38332372 ctatactattttttatgattaagaaacataaaaggcaatgaattgaagaaatacagaccctggcttgacgaagagcatcataagagtcaggagcagaagg 38332273  T
101 gcgttgaagaagaccgcggtcgaattcatcaatatgagtattgttactactactagtactagataccatgattttaggattgtgatgacgatagtgagga 200  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||    
38332272 gcgttgaagaagaccgctgtcgaattcatcaatatgagtattgttactgctactactactagataccatgattttaggattgtgatgacgatagtgagga 38332173  T
201 tgccattggcaaggtggtggtaacttgtgaggg 233  Q
    |||||||||||||||||||||||||||||||||    
38332172 tgccattggcaaggtggtggtaacttgtgaggg 38332140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University