View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12913_low_45 (Length: 251)
Name: NF12913_low_45
Description: NF12913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12913_low_45 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 38332372 - 38332140
Alignment:
| Q |
1 |
ctatactattttttatgattaagaaacataaaaggaaatgaattgaagaaatacagaccctggcttgacgaagagcatcatgagagtcaggagcagaagg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38332372 |
ctatactattttttatgattaagaaacataaaaggcaatgaattgaagaaatacagaccctggcttgacgaagagcatcataagagtcaggagcagaagg |
38332273 |
T |
 |
| Q |
101 |
gcgttgaagaagaccgcggtcgaattcatcaatatgagtattgttactactactagtactagataccatgattttaggattgtgatgacgatagtgagga |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38332272 |
gcgttgaagaagaccgctgtcgaattcatcaatatgagtattgttactgctactactactagataccatgattttaggattgtgatgacgatagtgagga |
38332173 |
T |
 |
| Q |
201 |
tgccattggcaaggtggtggtaacttgtgaggg |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
38332172 |
tgccattggcaaggtggtggtaacttgtgaggg |
38332140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University