View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12914_low_11 (Length: 204)

Name: NF12914_low_11
Description: NF12914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12914_low_11
NF12914_low_11
[»] chr1 (1 HSPs)
chr1 (14-189)||(43967028-43967203)


Alignment Details
Target: chr1 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 14 - 189
Target Start/End: Complemental strand, 43967203 - 43967028
Alignment:
14 aatataatgaccaacgtattacccccaacgttaatatgccgttaaaataaatacataaaaatgggttgatataattaattaatagatacagctataaaca 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43967203 aatataatgaccaacgtattacccccaacgttaatatgccgttaaaataaatacataaaaatgggttgatataattaattaatagatacagctataaaca 43967104  T
114 aggacaacatcaaccttcatccttacaattgttcatctggattaacattcaacataacttatgatattaataatga 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43967103 aggacaacatcaaccttcatccttacaattgttcatctggattaacattcaacataacttatgatattaataatga 43967028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University