View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12915_high_15 (Length: 340)
Name: NF12915_high_15
Description: NF12915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12915_high_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 251; Significance: 1e-139; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 63 - 325
Target Start/End: Original strand, 8777466 - 8777728
Alignment:
| Q |
63 |
ttagagaaaacattgatatgttcgattggactgcaacatccatgcatggaattaacctcaatatagtatgtaccaaatggcaatcaaccctaatgcaaaa |
162 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8777466 |
ttagataaaacattgatatgttcgattggactgcaacatccatgcatggaattaacctcaatatagcatgtaccaaatggcaatcaaccctaatgcaaaa |
8777565 |
T |
 |
| Q |
163 |
acagtggctcagcgccgtaagaagaagtctcccaaaaagggaggctgcagaaaaagttggaaaaaacctcctacaagaaaattgtatttttgaggcaagg |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8777566 |
acagtggctcagcgccgtaagaagaagtctcccaaaaagggaggctgcagaaaaagttggaaaaaacctcctacaagaaaattgtatttttgaggcaagg |
8777665 |
T |
 |
| Q |
263 |
tgttggttcttcaatgttgtgctcgttaagaaatctaatgaaaaatgatgcatgtgtgttgtt |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8777666 |
tgttggttcttcaatgttgtgctcgttaagaaatctaatgaaaaattatgcatgtgtgttgtt |
8777728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 12 - 67
Target Start/End: Original strand, 8762800 - 8762855
Alignment:
| Q |
12 |
atgaacatggatgccaaaactggtaattaagggcgcggttcaatgcatgcattaga |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
8762800 |
atgaacatggatgccaaaactggtaattaagggcgcagttcaatgcatgcattaga |
8762855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University