View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12915_high_19 (Length: 312)

Name: NF12915_high_19
Description: NF12915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12915_high_19
NF12915_high_19
[»] chr7 (2 HSPs)
chr7 (14-229)||(44802582-44802797)
chr7 (223-293)||(44802491-44802561)


Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 14 - 229
Target Start/End: Complemental strand, 44802797 - 44802582
Alignment:
14 agaaggtagaagagagcataaagagtgcacaagagacgtgtgctgatgacccagttagtggagaatgcgtagcagcatgggatgaagtggaggaactcag 113  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44802797 agaaggttgaagagagcataaagagtgcacaagagacgtgtgctgatgacccagttagtggagaatgcgtagcagcatgggatgaagtggaggaactcag 44802698  T
114 tgctgcagcgagtcatgcaagggataggaagaaggattctgaccccttggaggattactgtaaggataaccctgaaaccgacgagtgcaaaacatttgat 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44802697 tgctgcagcgagtcatgcaagggataggaagaaggattctgaccccttggaggattactgtaaggataaccctgaaaccgacgagtgcaaaacatttgat 44802598  T
214 acctgatttattatga 229  Q
    ||||||||||||||||    
44802597 acctgatttattatga 44802582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 223 - 293
Target Start/End: Complemental strand, 44802561 - 44802491
Alignment:
223 attatgagcattgattagtggtactgctgcactttgattgtgtttatttttatatgcatgtttatcttagc 293  Q
    ||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||    
44802561 attatgagcattgattaatggtactgctgcactttgattgtgtgtatttttatatgcatgtttatcttagc 44802491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University