View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12915_high_19 (Length: 312)
Name: NF12915_high_19
Description: NF12915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12915_high_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 14 - 229
Target Start/End: Complemental strand, 44802797 - 44802582
Alignment:
| Q |
14 |
agaaggtagaagagagcataaagagtgcacaagagacgtgtgctgatgacccagttagtggagaatgcgtagcagcatgggatgaagtggaggaactcag |
113 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44802797 |
agaaggttgaagagagcataaagagtgcacaagagacgtgtgctgatgacccagttagtggagaatgcgtagcagcatgggatgaagtggaggaactcag |
44802698 |
T |
 |
| Q |
114 |
tgctgcagcgagtcatgcaagggataggaagaaggattctgaccccttggaggattactgtaaggataaccctgaaaccgacgagtgcaaaacatttgat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44802697 |
tgctgcagcgagtcatgcaagggataggaagaaggattctgaccccttggaggattactgtaaggataaccctgaaaccgacgagtgcaaaacatttgat |
44802598 |
T |
 |
| Q |
214 |
acctgatttattatga |
229 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
44802597 |
acctgatttattatga |
44802582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 223 - 293
Target Start/End: Complemental strand, 44802561 - 44802491
Alignment:
| Q |
223 |
attatgagcattgattagtggtactgctgcactttgattgtgtttatttttatatgcatgtttatcttagc |
293 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
44802561 |
attatgagcattgattaatggtactgctgcactttgattgtgtgtatttttatatgcatgtttatcttagc |
44802491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University