View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12915_high_29 (Length: 235)
Name: NF12915_high_29
Description: NF12915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12915_high_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 15 - 176
Target Start/End: Original strand, 36380434 - 36380595
Alignment:
| Q |
15 |
agttttaagctcaccgtgtaacaatgcacattaggagcatgcaaagtatctaagagcatcttcaatgttcattttttctagaatctattgagttttatac |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
36380434 |
agttttaagctcaccgtgtaacaatgcacattaggagcatgcaaagtatctaagagcatcttcagtgttcattttttctaggatctattgagttttatac |
36380533 |
T |
|
| Q |
115 |
actactaaaacatggtccttcaatgccatatcatacgtataaaactcatacccttttgcttt |
176 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
36380534 |
actactaaaacatggtccttctatgccatatcatacgtatgaaagtcatacccttttgcttt |
36380595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 65 - 124
Target Start/End: Original strand, 43139636 - 43139696
Alignment:
| Q |
65 |
taagagcatcttcaatgttcattttttctagaatcta-ttgagttttatacactactaaaa |
124 |
Q |
| |
|
||||||||||||||||| ||||||||| | ||||||| |||||||| |||||||||||||| |
|
|
| T |
43139636 |
taagagcatcttcaatgatcattttttatggaatctatttgagtttcatacactactaaaa |
43139696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 102 - 164
Target Start/End: Complemental strand, 4309134 - 4309071
Alignment:
| Q |
102 |
ttgagttttatacactactaaaaca-tggtccttcaatgccatatcatacgtataaaactcata |
164 |
Q |
| |
|
|||| ||| |||||| ||||||||| |||||||||||||||| ||||||| ||| ||||||||| |
|
|
| T |
4309134 |
ttgaatttcatacacaactaaaacaatggtccttcaatgccacatcatacttatgaaactcata |
4309071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University