View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12915_low_25 (Length: 263)
Name: NF12915_low_25
Description: NF12915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12915_low_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 53096748 - 53096962
Alignment:
| Q |
1 |
gaggaaattaggctacataacaaggtcaaaatgaagttgagtaaaagaaatttactgcaaacaagaagcattagttgcatgcgtcgagcctggcaataat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
53096748 |
gaggaaattaggctacataacaaggtcaaaatgaagttgagtaaaagaaatttactgcaaacaagaagcattagttgcatacgtcgagcctggcaataat |
53096847 |
T |
|
| Q |
101 |
gttagaccttctgttaaaacaaccaaagatgtctaggtattaaccaaatgataaaatactttagtcatcaaccaagtaagaaaaatcactgcttgtaaca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
53096848 |
gttagaccttctgttaaaacaaccaaagatgtctaggtattaaccaaatgataaaatgctttagtcatcacccaagtaagaaaaatcactgcttgtaaca |
53096947 |
T |
|
| Q |
201 |
accaacgagcaaaat |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
53096948 |
accaacgagcaaaat |
53096962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University