View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12917_high_6 (Length: 348)
Name: NF12917_high_6
Description: NF12917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12917_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 38 - 334
Target Start/End: Complemental strand, 2587631 - 2587333
Alignment:
| Q |
38 |
ttccattccattccacacatttactgcactgcactgcatagnnnnnnn-attttctagaaatctattactctctgatttttaagatttcagctgtttata |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2587631 |
ttccattccattccacacatttactgcactgcactgcatagttttttttattttctagaaatctattactctctgatttttaagatttcagctgtttata |
2587532 |
T |
 |
| Q |
137 |
gtattactgttgagcggaaatgttttgccgattttgcccctgttccctttttt-agagtttttgtaattgttgctctaaaggtttggatctagatatttt |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2587531 |
gtattactgttgagcggaaatgttttgccgatttcgcccctgttccctttttttagagtttttgtaattgttgctctaaaggtttggatctagatatttt |
2587432 |
T |
 |
| Q |
236 |
gtttgtttaatattttacaaactctgttctgtttgatgcatgaaccgttttttagctactaggcaagaaattagtgaagggttatttaaagatgatgtc |
334 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2587431 |
gtttgttaaatattttacaaactctgttctgtttgatgcatgaaccattttttagctactaggcaagaaattagtgaagggttatttaaatatgatgtc |
2587333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University