View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12918_high_17 (Length: 246)

Name: NF12918_high_17
Description: NF12918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12918_high_17
NF12918_high_17
[»] chr1 (1 HSPs)
chr1 (10-230)||(7925777-7925995)


Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 10 - 230
Target Start/End: Complemental strand, 7925995 - 7925777
Alignment:
10 catcatcacactttatacttttatgaatggagcattatggaggtagttcacaagttattgttaatttggagtaatttttacttttagtacataactattg 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7925995 catcatcacactttatacttttatgaatggagcattatggaggtagttcacaagttattgttaatttggagtaatttttacttttagtacataactattg 7925896  T
110 ttgctgctgtagtgtaatgtgcaaggccaacgtatagattagtannnnnnnnnncatccgagtttaaattggcttttagttcattggaatttctcaatta 209  Q
    |||||||||||||||||||||||||||||||||||||||||||           ||||||||||||||||||||||||||||||||||||||||||||||    
7925895 ttgctgctgtagtgtaatgtgcaaggccaacgtatagattagt--tttttttttcatccgagtttaaattggcttttagttcattggaatttctcaatta 7925798  T
210 aaatatgtctatgattcttga 230  Q
    |||||||||||||||||||||    
7925797 aaatatgtctatgattcttga 7925777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University