View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12918_high_17 (Length: 246)
Name: NF12918_high_17
Description: NF12918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12918_high_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 10 - 230
Target Start/End: Complemental strand, 7925995 - 7925777
Alignment:
| Q |
10 |
catcatcacactttatacttttatgaatggagcattatggaggtagttcacaagttattgttaatttggagtaatttttacttttagtacataactattg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7925995 |
catcatcacactttatacttttatgaatggagcattatggaggtagttcacaagttattgttaatttggagtaatttttacttttagtacataactattg |
7925896 |
T |
|
| Q |
110 |
ttgctgctgtagtgtaatgtgcaaggccaacgtatagattagtannnnnnnnnncatccgagtttaaattggcttttagttcattggaatttctcaatta |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7925895 |
ttgctgctgtagtgtaatgtgcaaggccaacgtatagattagt--tttttttttcatccgagtttaaattggcttttagttcattggaatttctcaatta |
7925798 |
T |
|
| Q |
210 |
aaatatgtctatgattcttga |
230 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
7925797 |
aaatatgtctatgattcttga |
7925777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University