View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12918_high_8 (Length: 359)
Name: NF12918_high_8
Description: NF12918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12918_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 1 - 343
Target Start/End: Complemental strand, 28053389 - 28053046
Alignment:
| Q |
1 |
tgtcggaatcaatgtggatttgtaaaatcatgtgattttgtcaatcccaccgtgttaccaaacatgcacttagatcgaatgtgaatttttgatcgaatca |
100 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28053389 |
tgtcggactcaatgtagatttgtaaaatcatgtgattttgtcaatcccaccgtgttaccaaacatgcacttagatcgaatgtgaatttttgatcgaatca |
28053290 |
T |
 |
| Q |
101 |
cgtgcattttctaaccctttaataaaattatgatctagatatgattcgatcaaactcatcgtgttttgtttagtggtatcacattggatttgttagaatc |
200 |
Q |
| |
|
| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28053289 |
catgcattttctaactctttaataaaattatgatctagatatgattcgatcaaactcatcgtgttttgtttagtggtatcacattggatttgttagaatt |
28053190 |
T |
 |
| Q |
201 |
accttattgattgtaggttttgccaaatttcagtaaattccattagcgcaaatccatagtgatgccaacatgcaagatgtgaatttgatagtatcatgta |
300 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
28053189 |
accttattgattgtaggttttgctaaatttcagtaaattccattagcgcaaatccatagtgatgtcaacatgcaagatgtgaatttgatagtatcatgta |
28053090 |
T |
 |
| Q |
301 |
cattttgtagctctttaaaaattat-atatgattttgtcaagat |
343 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28053089 |
cattttgtagctctttaaaaattatgatatgattttgtcaagat |
28053046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University