View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12918_low_16 (Length: 255)
Name: NF12918_low_16
Description: NF12918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12918_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 11 - 239
Target Start/End: Complemental strand, 8251211 - 8250983
Alignment:
| Q |
11 |
catcatcacacaaaaatcatgactatactctcagccatattttgctgcttcaagtctgaagaagaagaagataagagtactcatgtggtggtggaagcag |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8251211 |
catcatcacacaaaaatcatgactatactctcagccatattctgctgcttcaagtctgaagaagaaga---taagagtactcatgtggtggtggaagcag |
8251115 |
T |
 |
| Q |
111 |
gttctttgtcaaagaaacccaaaggggaacctcaacgatcttcagctcctattgttgtttcttattttcctgttaattctcaaccttctcgtttg---ta |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| || |
|
|
| T |
8251114 |
gttctttgtcaaagaaacccaaaggggaacctcaacgatcttcagctcctattgttgtttcttatttccctgttaattctcaaccttctcgtttgtagta |
8251015 |
T |
 |
| Q |
208 |
gttgtgcatttaatttgtagatgcaaaacttg |
239 |
Q |
| |
|
||||| ||| ||||||||||||| |||||||| |
|
|
| T |
8251014 |
gttgtccatctaatttgtagatgtaaaacttg |
8250983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University