View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12918_low_18 (Length: 249)
Name: NF12918_low_18
Description: NF12918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12918_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 107; Significance: 9e-54; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 113 - 230
Target Start/End: Complemental strand, 28723183 - 28723065
Alignment:
| Q |
113 |
tagtgttgctgtatgggatcgaagttctttcgaatagggt-acttgtttgcttactacaataatattcatgtgcatttatatactgaaaaaataaaatat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28723183 |
tagtgttgctgtatgggatcgaagttctttcgactagggttacttgtttgcttactacaataatattcatgtgcatttatatactgaaaaaataaaatat |
28723084 |
T |
 |
| Q |
212 |
ttaaattacatatgtattg |
230 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
28723083 |
ttaaattacatatgtattg |
28723065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 113 - 230
Target Start/End: Complemental strand, 28730825 - 28730707
Alignment:
| Q |
113 |
tagtgttgctgtatgggatcgaagttctttcgaatagggt-acttgtttgcttactacaataatattcatgtgcatttatatactgaaaaaataaaatat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28730825 |
tagtgttgctgtatgggatcgaagttctttcgactagggttacttgtttgcttactacaataatattcatgtgcatttatatactgaaaaaataaaatat |
28730726 |
T |
 |
| Q |
212 |
ttaaattacatatgtattg |
230 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
28730725 |
ttaaattacatatgtattg |
28730707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 10 - 54
Target Start/End: Complemental strand, 28723286 - 28723242
Alignment:
| Q |
10 |
attattctctctcctatgacttgagtttagtactacttgtactcg |
54 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28723286 |
attattctctctcctatgacttgagtttagtactacttgtactcg |
28723242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 10 - 54
Target Start/End: Complemental strand, 28730928 - 28730884
Alignment:
| Q |
10 |
attattctctctcctatgacttgagtttagtactacttgtactcg |
54 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28730928 |
attattctctctcctatgacttgagtttagtactacttgtactcg |
28730884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 114 - 170
Target Start/End: Complemental strand, 28707830 - 28707773
Alignment:
| Q |
114 |
agtgttgctgtatgggatcgaagttctttcgaataggg-tacttgtttgcttactaca |
170 |
Q |
| |
|
|||| |||| |||||||||||||||||||| ||| ||| |||||||||||||| |||| |
|
|
| T |
28707830 |
agtgctgctatatgggatcgaagttctttcaaattgggttacttgtttgcttattaca |
28707773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University