View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12918_low_6 (Length: 425)
Name: NF12918_low_6
Description: NF12918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12918_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 1e-78; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 58 - 210
Target Start/End: Complemental strand, 6486830 - 6486678
Alignment:
| Q |
58 |
acaacaataataacattcctcgtccacagtttatgcaatccgaaccccgattttccacaacagaagcctatactgacgatgactatgccatgcgtagcag |
157 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6486830 |
acaacaacaataacattcctcgtccacagtttatgcaatccgaaccccgattttccacaacagaagcctatactgacgatgactatgccatgcgtagcag |
6486731 |
T |
|
| Q |
158 |
cagcgccgcctcccccatgagcccttactactacgaccctggaaggtctctcc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6486730 |
cagcgccgcctcccccatgagcccttactactacgaccctggaaggtctctcc |
6486678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 271 - 425
Target Start/End: Complemental strand, 6486616 - 6486462
Alignment:
| Q |
271 |
gttcgatgacccttagctcactagacgagctatttggattctttgcatgaacatggtgcagttcgctgcagaaccatttgatgtaaactgaatttgagtt |
370 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6486616 |
gttcgatgacccttagctcactagacgagctatttggattctttgcatgtacatggtgcagttcgctgcagaaccgtttgatgtaaactgaatttgagtt |
6486517 |
T |
|
| Q |
371 |
cacaaacggctctgcaatgtgctgcaccatacagagaatccaaatctaaataaaa |
425 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6486516 |
cacaaacggctctgcaatgtgctgcaccatacagagaatccaaatctaaataaaa |
6486462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University