View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12919_high_2 (Length: 309)
Name: NF12919_high_2
Description: NF12919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12919_high_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 86; Significance: 4e-41; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 92 - 239
Target Start/End: Original strand, 5689624 - 5689776
Alignment:
| Q |
92 |
ttatggtccaaaa-caatgatgacaaccataaggtacttttgcatcannnnnnn-ccttgtcatattcaaacaactactcattccaagcattatgcaaaa |
189 |
Q |
| |
|
|||||||||||| ||||||||||||||| | ||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5689624 |
ttatggtccaaattcaatgatgacaaccacatggtacttttgcatcattttttttccttgtcatattcaaacaactactcataccaagcattatgcaaaa |
5689723 |
T |
 |
| Q |
190 |
agaaaaatctccattacaaaatc---catcaaaccacttattatttctccact |
239 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5689724 |
agaaaaatctccattacaaaatcaatcatcaaaccacttattatttctccact |
5689776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University