View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1291_high_26 (Length: 354)

Name: NF1291_high_26
Description: NF1291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1291_high_26
NF1291_high_26
[»] chr8 (1 HSPs)
chr8 (293-354)||(12869708-12869769)
[»] chr7 (1 HSPs)
chr7 (293-354)||(41594009-41594070)
[»] chr5 (3 HSPs)
chr5 (296-354)||(14006881-14006939)
chr5 (314-354)||(23123796-23123836)
chr5 (314-346)||(23123876-23123908)
[»] chr2 (1 HSPs)
chr2 (293-354)||(43522613-43522674)
[»] chr3 (3 HSPs)
chr3 (238-293)||(36799798-36799853)
chr3 (30-76)||(36800015-36800061)
chr3 (314-354)||(22512371-22512411)


Alignment Details
Target: chr8 (Bit Score: 62; Significance: 1e-26; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 293 - 354
Target Start/End: Complemental strand, 12869769 - 12869708
Alignment:
293 tcttctcttgttatggcagattggcagtagcaatgttatcacggcccacccacattttgttc 354  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12869769 tcttctcttgttatggcagattggcagtagcaatgttatcacggcccacccacattttgttc 12869708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 62; Significance: 1e-26; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 293 - 354
Target Start/End: Original strand, 41594009 - 41594070
Alignment:
293 tcttctcttgttatggcagattggcagtagcaatgttatcacggcccacccacattttgttc 354  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41594009 tcttctcttgttatggcagattggcagtagcaatgttatcacggcccacccacattttgttc 41594070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 59; Significance: 6e-25; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 296 - 354
Target Start/End: Original strand, 14006881 - 14006939
Alignment:
296 tctcttgttatggcagattggcagtagcaatgttatcacggcccacccacattttgttc 354  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14006881 tctcttgttatggcagattggcagtagcaatgttatcacggcccacccacattttgttc 14006939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 314 - 354
Target Start/End: Complemental strand, 23123836 - 23123796
Alignment:
314 tggcagtagcaatgttatcacggcccacccacattttgttc 354  Q
    |||||||||||||||||||||||| ||||||||||||||||    
23123836 tggcagtagcaatgttatcacggctcacccacattttgttc 23123796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 314 - 346
Target Start/End: Complemental strand, 23123908 - 23123876
Alignment:
314 tggcagtagcaatgttatcacggcccacccaca 346  Q
    |||||||||||||||||||||||||||||||||    
23123908 tggcagtagcaatgttatcacggcccacccaca 23123876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 293 - 354
Target Start/End: Original strand, 43522613 - 43522674
Alignment:
293 tcttctcttgttatggcagattggcagtagcaatgttatcacggcccacccacattttgttc 354  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
43522613 tcttctcttgctatggcagattggcagtagcaatgttatcacggcccacccacattttgttc 43522674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 52; Significance: 9e-21; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 238 - 293
Target Start/End: Complemental strand, 36799853 - 36799798
Alignment:
238 actcttgatcttctctccaaaatttagagagatgtacatagtggatgtagaatatt 293  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
36799853 actcttgatcttctctccaaaatttagagagatgtacatagtggatgttgaatatt 36799798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 30 - 76
Target Start/End: Complemental strand, 36800061 - 36800015
Alignment:
30 tgtagtacccaaaaagaattcatacctttagctatgcggtggtaatt 76  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||    
36800061 tgtagtacccaaaaagaattcatacctttagctatgcggtagtaatt 36800015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 314 - 354
Target Start/End: Complemental strand, 22512411 - 22512371
Alignment:
314 tggcagtagcaatgttatcacggcccacccacattttgttc 354  Q
    |||||||||||||||||||||||||||||||||||||||||    
22512411 tggcagtagcaatgttatcacggcccacccacattttgttc 22512371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University