View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1291_high_28 (Length: 343)
Name: NF1291_high_28
Description: NF1291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1291_high_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 5e-87; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 5e-87
Query Start/End: Original strand, 164 - 334
Target Start/End: Complemental strand, 39612964 - 39612794
Alignment:
| Q |
164 |
cttctttttcgatgcttgtgatggttgtcatcaccacaagaaaatatgatgatggataaaactgaaagagacagaaagataattcccaataaatataaaa |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39612964 |
cttctttttcgatgcttgtgatggttgtcatcaccacaagaaaatatgatgatggataaaactgaaagagacagaaagataattcccaataaatataaaa |
39612865 |
T |
 |
| Q |
264 |
ttcctgaattataatctccttggccaccaccaagtatagcatgaaattctctagccattactcagtataat |
334 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39612864 |
ttcctgaattataatctccctggccaccaccaagtatagcatgaaattctctagccattactcagaataat |
39612794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 70
Target Start/End: Complemental strand, 39613098 - 39613058
Alignment:
| Q |
30 |
cataccaatgtatatttgtgtacaaaagataattgatctag |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39613098 |
cataccaatgtatatttgtgtacaaaagataattgatctag |
39613058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University