View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1291_high_35 (Length: 300)
Name: NF1291_high_35
Description: NF1291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1291_high_35 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 61 - 242
Target Start/End: Complemental strand, 572760 - 572579
Alignment:
| Q |
61 |
acagacaatgatgtaaaaaatttctggagcagtagacaaaaaaggttggctaggcttctcaaaacatcatcgtcaacaacctcaaagtcacacaaaaaca |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
572760 |
acagacaatgatgtaaaaaatttctggagcagtagacaaaaaaggttggctaggcttctcaaaacatcatcatcaacaacctcaaagtcacacaaaaaca |
572661 |
T |
|
| Q |
161 |
aagccaaagtttcttcccatgttccatcttacgaggtaattaaaaaacacatgttactctttttcttgtcttggttctctgc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
572660 |
aagccaaagtttcttcccatgttccatcttacgaggtaattaaaaaacacatgttactctttttcttgtcttggttctctgc |
572579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University