View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1291_high_38 (Length: 296)
Name: NF1291_high_38
Description: NF1291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1291_high_38 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 95; Significance: 2e-46; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 7109025 - 7109135
Alignment:
| Q |
1 |
taaatcctctttgatgattagaaatgaggttaggcatgattctagctaacctttcagcaatcactttggttataattttaaacttgaagttatctaaagc |
100 |
Q |
| |
|
||||| ||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7109025 |
taaattctctttgctgcttagaaatgaggttaggcatgattctagctaacctttcagcaatcactttggttataattttaaacttgaagttatctaaagc |
7109124 |
T |
 |
| Q |
101 |
tataggcctat |
111 |
Q |
| |
|
|||||| |||| |
|
|
| T |
7109125 |
tataggtctat |
7109135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University