View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1291_high_40 (Length: 291)
Name: NF1291_high_40
Description: NF1291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1291_high_40 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 89; Significance: 6e-43; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 137 - 241
Target Start/End: Complemental strand, 42871049 - 42870945
Alignment:
| Q |
137 |
attagtaaccaagcagcctttccaggttaataaaaccatacctcttcgagtttacaaaaccgaaccaccgcaacagaagccacatttgttaccaccaaat |
236 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| |||||||||| |||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42871049 |
attagtaaccaagcagcctttccagattaataaaaccataccttttcgagtttaaaaaaccgaaccaccgcaaaagaagccacatttgttaccaccaaat |
42870950 |
T |
|
| Q |
237 |
ctctg |
241 |
Q |
| |
|
||||| |
|
|
| T |
42870949 |
ctctg |
42870945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 54 - 142
Target Start/End: Complemental strand, 42873230 - 42873142
Alignment:
| Q |
54 |
agaatcaagcataggatcaccaactcagctgatttcacaagaaaaaacatgtttgaacccagatcaagggacaagatcaacacattagt |
142 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42873230 |
agaatcaagcataggatcaccaactcagttaatttcacaagaaaaaacatgtttgaacccagatcaagggacaagatcaacacattagt |
42873142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University