View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1291_high_58 (Length: 235)

Name: NF1291_high_58
Description: NF1291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1291_high_58
NF1291_high_58
[»] chr7 (2 HSPs)
chr7 (14-77)||(39670305-39670368)
chr7 (189-235)||(39670148-39670194)


Alignment Details
Target: chr7 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 14 - 77
Target Start/End: Complemental strand, 39670368 - 39670305
Alignment:
14 agagcatgaaagagacccacggcttacctcacatccacattacaacgaggatataaccataaag 77  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39670368 agagcatgaaagagacccacggcttacctcacatccacattacaacgaggatataaccataaag 39670305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 189 - 235
Target Start/End: Complemental strand, 39670194 - 39670148
Alignment:
189 gataatccattcacagacaaatccattcacataaacccttagaaaat 235  Q
    |||||||||| |||| |||||||||||||||||| | ||||||||||    
39670194 gataatccatgcacaaacaaatccattcacataagcacttagaaaat 39670148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University