View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1291_high_58 (Length: 235)
Name: NF1291_high_58
Description: NF1291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1291_high_58 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 14 - 77
Target Start/End: Complemental strand, 39670368 - 39670305
Alignment:
| Q |
14 |
agagcatgaaagagacccacggcttacctcacatccacattacaacgaggatataaccataaag |
77 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39670368 |
agagcatgaaagagacccacggcttacctcacatccacattacaacgaggatataaccataaag |
39670305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 189 - 235
Target Start/End: Complemental strand, 39670194 - 39670148
Alignment:
| Q |
189 |
gataatccattcacagacaaatccattcacataaacccttagaaaat |
235 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||| | |||||||||| |
|
|
| T |
39670194 |
gataatccatgcacaaacaaatccattcacataagcacttagaaaat |
39670148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University