View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1291_high_59 (Length: 227)
Name: NF1291_high_59
Description: NF1291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1291_high_59 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 147
Target Start/End: Original strand, 32260553 - 32260699
Alignment:
| Q |
1 |
catttcttattggaccattgatttggggtttgattattccgagtggaccccctttagggacaacattggttgaaaagtgtgaacttatcatctcagaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32260553 |
catttcttattggaccattgatttggggtttgattattccgagtggaccccctttagggacaacattggttgaaaagtgtgaacttatcatctcagaatt |
32260652 |
T |
 |
| Q |
101 |
tttgttacctttcttctttgtttatgttggcatgaccacaaatttgg |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32260653 |
tttgttacctttcttctttgtttatgttggcatgaccacaaatttgg |
32260699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 142 - 226
Target Start/End: Complemental strand, 32260892 - 32260808
Alignment:
| Q |
142 |
atttggtgcaatttaataaaggttataaggtgaggtatgcccttgatgttcaacatgaggccaagcactgtgccatgtttgggct |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32260892 |
atttggtgcaatttaataaaggttataaggtgaggtatgcccttgatgttcaacatgaggccaagcactgtgccatgtttgggct |
32260808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University