View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1291_high_60 (Length: 215)
Name: NF1291_high_60
Description: NF1291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1291_high_60 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 28 - 196
Target Start/End: Original strand, 18021539 - 18021707
Alignment:
| Q |
28 |
gtgagatgaaacttctcaaa-tttgttgtatcaaaagaatagtagaaaatttgaataaaggtaaaatctttctcaagacaaagatgcccaaacctttcga |
126 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18021539 |
gtgagatgaaacttctcaaaatttgttgtatcaaaagaatagtagaaaatttgaataaaggtaaaatctttctcaagacaaagatgcccaaacctttcga |
18021638 |
T |
 |
| Q |
127 |
caatcaactttagaggagaggagccggatcnnnnnnnntgggttcgcctactctatgtcatgacattact |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
18021639 |
caatcaactttagaggagaggagccggatc-aaaaaaatgagttcgcctactctatgtcatgacattact |
18021707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University